|
Servicebio Inc
universal reverse pcr primer Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc13145395-9-2-7?v=Servicebio+Inc Average 86 stars, based on 1 article reviews
universal reverse pcr primer - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Eurofins
htrac hdr genomic reverse primer targeting rha Htrac Hdr Genomic Reverse Primer Targeting Rha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc13265900-95-0-9?v=Eurofins Average 86 stars, based on 1 article reviews
htrac hdr genomic reverse primer targeting rha - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
reverse primers Reverse Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm42276401-117-20-24?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
reverse primers - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Eurofins
reverse primers Reverse Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm42268715-402-22-27?v=Eurofins Average 86 stars, based on 1 article reviews
reverse primers - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
OriGene
gaatgccaccttcatccgagaag reverse Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm42234557-282-119-122?v=OriGene Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
gcgacatactcaagcaggagca reverse Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm42234557-282-130-133?v=OriGene Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
tcgcctccaactcaagctggtt reverse Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm42234557-282-97-100?v=OriGene Average 94 stars, based on 1 article reviews
tcgcctccaactcaagctggtt reverse - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
tiangen biotech co
reverse primer Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc13019757-148-71-77?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
Eurofins
n a htrac hdr genomic reverse primer targeting rha N A Htrac Hdr Genomic Reverse Primer Targeting Rha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/10__1016_slash_j__isci__2026__116175-216-48-57?v=Eurofins Average 86 stars, based on 1 article reviews
n a htrac hdr genomic reverse primer targeting rha - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
tiangen biotech co
primer Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc13010918-87-22-17?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
primer - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |